Filters
Question type

Study Flashcards

Two-dimensional gel electrophoresis separates proteins based on _______ and _______.


A) size;concentration
B) size;shape
C) size;charge
D) concentration;shape
E) shape;charge

Correct Answer

verifed

verified

Haplotype maps are based primarily on


A) the positions of transposons.
B) variations at specific nucleotides.
C) whether or not open reading frames exist.
D) the extent to which a gene is expressed.
E) where on the chromosome the gene is located.

Correct Answer

verifed

verified

Approximately how many Mycoplasma genitalium genomes would be equivalent to the haploid human genome (in terms of base pairs) ?


A) 55
B) 250
C) 550
D) 5,500
E) 25,000

Correct Answer

verifed

verified

Which statement about the globin genes in humans is false?


A) They are all expressed at the same time.
B) They all arose from a single common ancestor gene.
C) They are an example of a gene family.
D) Some of the different genes carry out different functions.
E) All of the above are true;none is false.

Correct Answer

verifed

verified

Use the following to answer questions : The hypothetical anti-anxiety drug Epitome is inactive when taken,but it is activated by the rasputin enzyme a few hours after injection.Alleles 1 and 2 of the gene that encodes rasputin have similar activity levels.Individuals with one or both copies of allele 3,which is very rare,have much higher levels of enzyme activity.Individuals who have both copies of allele 4 have much lower levels of enzyme activity.Heterozygotes of allele 4 have normal levels of enzyme activity. -The Epitome drug would be most likely to be ineffective in individuals whose genotype has one copy of allele _______ and one copy of allele _______.


A) 4;4
B) 2;4
C) 2;3
D) 2;2
E) 1;4

Correct Answer

verifed

verified

A DNA sequence has been cut into the four overlapping sequence fragments below: (1) AGGGGCCTATAGCATACGTACA (2) CGTACATCTGAGGGTACGATCATGGC (3) CATGGCTAGCAAACGCGATCCCAAG (4) AGGCTAGTTACGATATAGGGGCC What is the correct order of these fragments?


A) 1;2;3;4
B) 1;3;2;4
C) 2;3;1;4
D) 4;1;2;3
E) 4;1;3;2

Correct Answer

verifed

verified

Which statement would be considered an expression of genetic determinism?


A) The proteome is more complex than the genome.
B) All people who are homozygous for the sickle-cell allele have sickle-cell disease.
C) Studying genes provides a limited understanding of what is going on in the cell.
D) The metabolome exerts considerable influence on the likelihood that an individual will develop diabetes.
E) High levels of glucose may be an indicator of coronary heart disease.

Correct Answer

verifed

verified

Which DNA sequence would be the most difficult to assemble?


A) A sequence with an ORF
B) A sequence consisting of several short repeated fragments
C) A sequence with roughly equal proportions of As,Cs,Gs,and Ts
D) A sequence with a promoter
E) A sequence that contains the fragment CAGCTATT

Correct Answer

verifed

verified

The closest living relatives to humans are _______,followed next by _______.


A) chimpanzees;gorillas
B) chimpanzees;gibbons
C) gorillas;orangutans
D) gorillas;chimpanzees
E) orangutans;chimpanzees

Correct Answer

verifed

verified

If the universal adapter sequence is GTCATTGCTTGCAATGTT,which universal primer should be used for DNA sequencing?


A) GTCATTGCTTGCAATGTT
B) TTGTAACGTTCGTTACTG
C) CAGTAACGAACGTTACAA
D) CCTGAATTGGTCGTACAA
E) GUCAUUGCUUGCAAUGUU

Correct Answer

verifed

verified

Rank the following in terms of their relationship to the phenotypic characteristics of a cell or organism (from closest to most distant) : the genome,the proteome,and the metabolome.


A) Genome;proteome;metabolome
B) Genome;metabolome;proteome
C) Proteome;metabolome;genome
D) Proteome;genome;metabolome
E) Metabolome;proteome;genome

Correct Answer

verifed

verified

Which genome is most likely that of a free-living prokaryote?


A) A genome that is 300 million bp long with over 50 percent repetitive DNA and many introns
B) A genome that is 16,000 bp long and arranged in a circle
C) A genome that is 3 million bp long,arranged in a single circular chromosome,and has little repetitive DNA
D) A genome that is 3 million bp long,is arranged in many linear chromosomes,and has many introns
E) A genome that is a billion bp long,is arranged in many linear chromosomes,and has many introns

Correct Answer

verifed

verified

The gene most responsible for differences in size among different breeds of dogs is the _______ gene.


A) myostatin
B) phosphofructokinase
C) insulin-like growth factor
D) tyrosine growth factor
E) giant

Correct Answer

verifed

verified

Which statement about the human genome is true?


A) In any given specialized cell type,most of the genome is being transcribed.
B) Most transcripts are cell-type specific.
C) Most transposons are active most of the time.
D) Noncoding RNAs seldom,if ever,perform regulatory roles.
E) Both a and b

Correct Answer

verifed

verified

A study comparing the proteins that are produced in sperm cells to those of skin cells is an example of


A) comparative genomics.
B) functional genomics.
C) pharmacogenomics.
D) metabolomics.
E) proteomics.

Correct Answer

verifed

verified

Which of the following is a major difference between LINEs and SINEs?


A) Proteins sometimes are translated from LINEs but they never are from SINEs.
B) SINEs make RNA copies of themselves,whereas LINEs do not.
C) LINEs make RNA copies of themselves,whereas SINEs do not.
D) SINEs are larger than LINEs.
E) SINEs can move from place to place in the genome,whereas LINEs cannot.

Correct Answer

verifed

verified

Which statement about eukaryotic genomes as compared with prokaryotic genomes is false?


A) They tend to be larger.
B) They tend to have more regulatory sequences.
C) The percentage of the genome devoted to coding sequence is higher.
D) They usually have more repetitive DNA.
E) They usually have more protein-coding genes.

Correct Answer

verifed

verified

Studies of the relative efficacy or nonefficacy of a drug based on specific genotypes would be considered part of the field of


A) metagenomics.
B) metabolomics.
C) proteomics.
D) pharmacogenomics
E) comparative genomics.

Correct Answer

verifed

verified

Craig Venter,a leader of one of the teams that sequenced the human genome,has now turned his attention to cataloging the microbial life of the oceans.His studies,which involve PCR amplification of microbial DNA and a sequencing of the PCR products,are part of a field of biology called


A) functional genomics.
B) transposon tagging.
C) proteomics.
D) phenomics.
E) metagenomics.

Correct Answer

verifed

verified

DNA fingerprinting most often is based on


A) SNPs.
B) open reading frames.
C) telomeres.
D) repetitive DNA.
E) transposons.

Correct Answer

verifed

verified

Showing 21 - 40 of 78

Related Exams

Show Answer